Spa17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spa17^em1(IMPC)J
• Name: sperm autoantigenic protein 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6315580
• Gene: Spa17 Location: Chr9:37514590-37525018 bp, - strand Genetic Position: Chr9, 20.78 cM, cytoband B
• Alliance: Spa17^em1(IMPC)J page
• IMPC: Spa17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACACACTTCTCAAAACTT and TTACTTATGTCTACAGCACT, which resulted in a 241 bp deletion beginning at Chromosome 9 position 37,607,588 bp and ending after 37,607,828 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216909 (exon 3) and 170 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spa17 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)