Cdyl2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdyl2^em1(IMPC)Tcp
• Name: chromodomain protein, Y chromosome-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316169
• Gene: Cdyl2 Location: Chr8:117301139-117459730 bp, - strand Genetic Position: Chr8, 63.15 cM, cytoband E1
• Alliance: Cdyl2^em1(IMPC)Tcp page
• IMPC: Cdyl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1032 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) with spacer sequences of TCCGGGAGGATGACGAGTCC targeting the 5' side and TGGTGAGTTAGCAACACGCC targeting the 3' side of a critical exon. This resulted in a 596-bp del Chr8: 116594751 to 116595346 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdyl2 Mutation: 86 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 3 reference(s)