Ing4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ing4^em1(IMPC)Tcp
• Name: inhibitor of growth family, member 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316191
• Gene: Ing4 Location: Chr6:125016811-125026228 bp, + strand Genetic Position: Chr6, 59.17 cM
• Alliance: Ing4^em1(IMPC)Tcp page
• IMPC: Ing4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR443 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of ATAGTTCAGTACAGTTCACT and GTATGTTTCATCTAGCCACC targeting the 5' side and GAATTAGCTGAGAGCTAGGT and TCCAAGCCTGGCTCCGATCA targeting the 3' side of a critical exon resulting in a 398-bp deletion on Chr6 from 125046790 to 125047187 (GRCm38). (J:200814)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ing4 Mutation: 34 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 3 reference(s)