Nans^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nans^em1(IMPC)Tcp
• Name: N-acetylneuraminic acid synthase (sialic acid synthase); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316200
• Gene: Nans Location: Chr4:46489319-46503439 bp, + strand Genetic Position: Chr4, 24.83 cM, cytoband B2
• Alliance: Nans^em1(IMPC)Tcp page
• IMPC: Nans gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1155 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TTCTTGTAGCAACTGATGGC and GAGGGAATACCTTTCACTAT targeting the 5' side and TAGTGTCGTGTGGAGACGTT and ATGGAAGCAGGTCGTATTAC targeting the 3' side of a critical exon. This resulted in a 673-bp del Chr4:46498890 to 46499562 with an insertion of 152-bp resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38) (J:200814)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nans Mutation: 19 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 3 reference(s)