Tmem65^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem65^em1(IMPC)Tcp
• Name: transmembrane protein 65; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316224
• Gene: Tmem65 Location: Chr15:58654118-58695487 bp, - strand Genetic Position: Chr15, 25.09 cM
• Alliance: Tmem65^em1(IMPC)Tcp page
• IMPC: Tmem65 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1187 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCAGCATAACTCCTGTCAAGTAA targeting the 5' side and AGTAAAGAAATTAGTGTGCTCTA targeting the 3' side of a critical exon. This resulted in a 242-bp deletion Chr15:58794295 to 58794536 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem65 Mutation: 17 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 3 reference(s)