Vps37a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vps37a^em1(IMPC)Tcp
• Name: vacuolar protein sorting 37A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316230
• Gene: Vps37a Location: Chr8:40964824-41003798 bp, + strand Genetic Position: Chr8, 23.89 cM, cytoband B1.2
• Alliance: Vps37a^em1(IMPC)Tcp page
• IMPC: Vps37a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1166 was generated at The Centre for Phenogenomics by electroporation of Cpf1 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTATTCTCGTGTTATTCCTT targeting the 5' side and CCTGGAGAATACTGTTTACTT targeting the 3' side leading to the deletion of 257-bp on Chr8 from 40528311 to 40528567 (GRCm38) deleting a critical exon and resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vps37a Mutation: 15 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 3 reference(s)