Plcg2^em1Msasn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plcg2^em1Msasn
• Name: phospholipase C, gamma 2; endonuclease-mediated mutation 1, Michael Sasner
• MGI ID: MGI:6316314
• Synonyms: Plcg2^P522R, Plcg2^R522
• Gene: Plcg2 Location: Chr8:118225030-118361881 bp, + strand Genetic Position: Chr8, 64.26 cM
• Alliance: Plcg2^em1Msasn page

Mutation origin

• Strain of Origin: B6(SJL)-Apoe^{tm1.1(APOE*4)Adiuj}/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: A C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease. (J:308279)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plcg2 Mutation: 74 strains or lines available

References

• Original: J:308279 Maguire E, et al., PIP2 depletion and altered endocytosis caused by expression of Alzheimer's disease-protective variant PLCgamma2 R522. EMBO J. 2021 Jul 13;:e105603
• All: 3 reference(s)