Exosc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exosc1^em1(IMPC)J
• Name: exosome component 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6316601
• Synonyms: Exosc1^-
• Gene: Exosc1 Location: Chr19:41911417-41921836 bp, - strand Genetic Position: Chr19, 35.46 cM, cytoband D1
• Alliance: Exosc1^em1(IMPC)J page
• IMPC: Exosc1 gene page

Exosc1^em1(IMPC)J/Exosc1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos at E5.5 appear as normal egg cylinder although with slightly disorganized ectoderm and at E7.5 are smaller and do not initiate gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTATGGATGTCACATACCA and GGACTTTAGCTCAGATTGAA, which resulted in a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278630, ENSMUSE00000278546 (exons 4-7) and 3366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 64 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	11 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Exosc1 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)