Mphosph8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mphosph8^em1(IMPC)J
• Name: M-phase phosphoprotein 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6316624
• Gene: Mphosph8 Location: Chr14:56905705-56934887 bp, + strand Genetic Position: Chr14, 28.37 cM
• Alliance: Mphosph8^em1(IMPC)J page
• IMPC: Mphosph8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAATAGTCTTGGTGGCGGG and TGTGTATTATGTGTACACCA, which resulted in a 319 bp deletion beginning at Chromosome 14 position 56,676,388 bp and ending after 56,676,706 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309555 (exon 4) and 222 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 406 and early truncation 38 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mphosph8 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)