Ino80c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ino80c^em1(IMPC)J
• Name: INO80 complex subunit C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6316629
• Gene: Ino80c Location: Chr18:24237818-24254876 bp, - strand Genetic Position: Chr18, 12.74 cM
• Alliance: Ino80c^em1(IMPC)J page
• IMPC: Ino80c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATGTCTCTCTAGACAGA and CCCGCCTTACAGAAAATGGA, which resulted in a 2807 bp deletion beginning at Chromosome 18 position 24,111,655 bp and ending after 24,114,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222154, ENSMUSE00000365673 (exon 2-4) and 2516 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 a deletion of 97 amino acids and then returns in frame for an additional 43 amino acid. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ino80c Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)