Slc7a3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc7a3^em1(IMPC)J
• Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6316637
• Gene: Slc7a3 Location: ChrX:100122816-100129626 bp, - strand Genetic Position: ChrX, 43.72 cM
• Alliance: Slc7a3^em1(IMPC)J page
• IMPC: Slc7a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTCTGGGCCTTCACCAC and TGGCAGGCACTTCGAAGATT, which resulted in a 441 bp deletion beginning at Chromosome X position 101,083,784 bp and ending after 101,084,224 bp (GRCm38/mm10). This mutation deletes 354 bp of ENSMUSE00001284891 (exon 3) after the first 54 bp as well as 87 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc7a3 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)