Mbip^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mbip^em1(IMPC)J
• Name: MAP3K12 binding inhibitory protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317348
• Synonyms: Mbip^-
• Gene: Mbip Location: Chr12:56375091-56392681 bp, - strand Genetic Position: Chr12, 24.3 cM
• Alliance: Mbip^em1(IMPC)J page
• IMPC: Mbip gene page

Mbip^em1(IMPC)J/Mbip^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTCACCTTCACTTTCTAA and TTAGTAACTTTGAGCAAAAT, which resulted in a 2527 bp deletion beginning at Chromosome 12 position 56,339,932 bp and ending after 56,342,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314161 through ENSMUSE00000114025 (exons 2 through 4) and 2091 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 20 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mbip Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)