Smim20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smim20^em1(IMPC)J
• Name: small integral membrane protein 20; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317363
• Synonyms: Smim20 KO
• Gene: Smim20 Location: Chr5:53424448-53435882 bp, + strand Genetic Position: Chr5, 29.05 cM
• Alliance: Smim20^em1(IMPC)J page
• IMPC: Smim20 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGGTGTGACATTACAAG and TACAAATAGCTATTACTACA, which resulted in a 1929 bp deletion beginning at Chromosome 5 position 53,276,856 bp and ending after 53,278,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254968 and ENSMUSE00000766691 (exons 2 and 3) and 1228 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 2 amino acids later. There is a 2 bp TG insertion at the deletion site. RT-qPCR analysis demonstrated the absence of Smim20 mRNA expression in the hypothalamus of homozygous mutant females. (J:188991, J:350521)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smim20 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)