Znhit1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Znhit1^em1(IMPC)J
• Name: zinc finger, HIT domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317369
• Synonyms: Znhit1^-
• Gene: Znhit1 Location: Chr5:137011048-137016813 bp, - strand Genetic Position: Chr5, 76.09 cM, cytoband G1
• Alliance: Znhit1^em1(IMPC)J page
• IMPC: Znhit1 gene page

Znhit1^em1(IMPC)J/Znhit1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 exhibit abnormal inner cell mass, primitive endoderm, and trophectoderm morphology.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGCCCTCTGTGTCATGGGA and TGGGGCAAAGAGAGTTACCG, which resulted in a 2990 bp deletion beginning at Chromosome 5 position 136,982,083 bp and ending after 136,985,072 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000498794 through ENSMUSE00000686647 (exons 2 through 5) and 2315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Znhit1 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)