About   Help   FAQ
Znhit1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Znhit1em1(IMPC)J
Name: zinc finger, HIT domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6317369
Synonyms: Znhit1-
Gene: Znhit1  Location: Chr5:137011048-137016813 bp, - strand  Genetic Position: Chr5, 76.09 cM, cytoband G1
Alliance: Znhit1em1(IMPC)J page
IMPC: Znhit1 gene page
Znhit1em1(IMPC)J/Znhit1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 exhibit abnormal inner cell mass, primitive endoderm, and trophectoderm morphology.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGCCCTCTGTGTCATGGGA and TGGGGCAAAGAGAGTTACCG, which resulted in a 2990 bp deletion beginning at Chromosome 5 position 136,982,083 bp and ending after 136,985,072 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000498794 through ENSMUSE00000686647 (exons 2 through 5) and 2315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Znhit1 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory