Nsl1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nsl1^em1(IMPC)J
• Name: NSL1, MIS12 kinetochore complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6317375
• Synonyms: Nsl1^-
• Gene: Nsl1 Location: Chr1:190794710-190816755 bp, + strand Genetic Position: Chr1, 96.28 cM
• Alliance: Nsl1^em1(IMPC)J page
• IMPC: Nsl1 gene page

Nsl1^em1(IMPC)J/Nsl1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCAGTGCGGAGATGAGGG and TAGACCTGAGGCAAATGCTG, which resulted in a 483 bp deletion beginning at Chromosome 1 position 191,069,888 bp and ending after 191,070,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461366 (exon 3) and 352 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nsl1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)