Eif5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eif5b^em1(IMPC)J
• Name: eukaryotic translation initiation factor 5B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324040
• Synonyms: Eif5b^-
• Gene: Eif5b Location: Chr1:38037091-38094660 bp, + strand Genetic Position: Chr1, 16.4 cM
• Alliance: Eif5b^em1(IMPC)J page
• IMPC: Eif5b gene page

Eif5b^em1(IMPC)J/Eif5b^em1(IMPC)J mice exhibit embryonic lethality, with no embryos detected at E7.5 and lower number of embryos than expected at E3.5 that appear as morulae. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCATCCCTTAAAGGTCATG and AGAAGGCTCTGGTTCATGTT, which resulted in a 800 bp deletion beginning at Chromosome 1 position 38,018,772 bp and ending after 38,019,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340970 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 75 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eif5b Mutation: 66 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)