Dennd2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dennd2b^em1(IMPC)J
• Name: DENN domain containing 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324043
• Gene: Dennd2b Location: Chr7:109123118-109302812 bp, - strand Genetic Position: Chr7, 57.27 cM, cytoband F2
• Alliance: Dennd2b^em1(IMPC)J page
• IMPC: Dennd2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACCGGAAGTCACAGAAC and GGGTAGATGGGACTTCTTGG, which resulted in a 1217 bp deletion beginning at Chromosome 7 position 109,556,205 bp and ending after 109,557,421 bp (GRCm38/mm10). This mutation deletes 1211 bp of ENSMUSE00000384284 (exon 3) after the first 40 bp and 6 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 36 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dennd2b Mutation: 157 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)