Krt86^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt86^em1(IMPC)Tcp
• Name: keratin 86; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6324176
• Gene: Krt86 Location: Chr15:101371359-101377864 bp, + strand Genetic Position: Chr15, 56.9 cM
• Alliance: Krt86^em1(IMPC)Tcp page
• IMPC: Krt86 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1329 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTTGATACCAACCTCATCT and GTCCTGATAGGTCTTTCTGG targeting the 5' side and TTAGGTCAAAGGTTACATCA and TCGCTCTAAGGCTGCCTACG targeting the 3' side of a critical region. This resulted in a 2491-bp deletion of Chr15 from 101475207 to 101477697 (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krt86 Mutation: 19 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)