Exosc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exosc2^em1(IMPC)J
• Name: exosome component 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324232
• Synonyms: Exosc2^-
• Gene: Exosc2 Location: Chr2:31560727-31571361 bp, + strand Genetic Position: Chr2, 21.86 cM
• Alliance: Exosc2^em1(IMPC)J page
• IMPC: Exosc2 gene page

Exosc2^em1(IMPC)J/Exosc2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but no embryos at E7.5. Embryos at E3.5 appear as blastocysts but fail to hatch from the zona pellucida or form outgrowths when grown in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGCTTACCAATAGCCAGC and TGAGAAGTCTGCTTCACATG, which resulted in a 378 bp deletion beginning at Chromosome 2 position 31,674,483 bp and ending after 31,674,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001310800 and ENSMUSE00001254592 (exons 3 and 4) and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	2 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Exosc2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)