Taf5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taf5^em1(IMPC)J
• Name: TATA-box binding protein associated factor 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324237
• Synonyms: Taf5^-
• Gene: Taf5 Location: Chr19:47056187-47071918 bp, + strand Genetic Position: Chr19, 39.19 cM
• Alliance: Taf5^em1(IMPC)J page
• IMPC: Taf5 gene page

Taf5^em1(IMPC)J/Taf5^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATAACCCTGACTAGGCTGT and GCAGTACTGGATTCCTCCCA, which resulted in a 583 bp deletion beginning at Chromosome 19 position 47,074,658 bp and ending after 47,075,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000375459 (exon 3) and 267 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 267 and early truncation 5 amino acids later. No Taf5 transcript was detected in RNA sequencing of homozygous mutant embryos indicating complete loss of function. (J:188991, J:348275)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	41 assay results
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Taf5 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)