Fam43a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam43a^em1(IMPC)J
• Name: family with sequence similarity 43, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324370
• Gene: Fam43a Location: Chr16:30418541-30421615 bp, + strand Genetic Position: Chr16, 21.34 cM
• Alliance: Fam43a^em1(IMPC)J page
• IMPC: Fam43a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCTCCTCCCCTGTCCGCG and TTTTGGATCAGACCAACTCG, which resulted in a 3280 bp deletion beginning at Chromosome 16 position 30,599,668 bp and ending after 30,602,947 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343942 (exon 1) and 205 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam43a Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)