About   Help   FAQ
Adgrg4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adgrg4em1(IMPC)J
Name: adhesion G protein-coupled receptor G4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6330722
Gene: Adgrg4  Location: ChrX:55939594-56025719 bp, + strand  Genetic Position: ChrX, 30.34 cM
Alliance: Adgrg4em1(IMPC)J page
IMPC: Adgrg4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTCTTCCCAAACTAC and CCAACTGCCAAAGAGTCTAC, which resulted in a 5813 bp deletion beginning at Chromosome X position 56,913,220 bp and ending after 56,919,032 bp (GRCm38/mm10). This mutation deletes 5813 bp of ENSMUSE00000386381 (exon 3) and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 9 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adgrg4 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory