Ist1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ist1^em1(IMPC)J
• Name: increased sodium tolerance 1 homolog (yeast); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6331113
• Gene: Ist1 Location: Chr8:110397957-110419892 bp, - strand Genetic Position: Chr8, 57.18 cM
• Alliance: Ist1^em1(IMPC)J page
• IMPC: Ist1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATCTTGTACACAAGCTTC and AGGGGAGTAGATGTGCTAAG, which resulted in a 978 bp deletion beginning at Chromosome 8 position 109,681,965 bp and ending after 109,682,942 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000212413 and ENSMUSE00000212415 (exons 3 and 4) and 709 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29and early truncation 26 amino acids later. There is a 7 bp intronic deletion 96 bp before the larger deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ist1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)