Qsox2^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Qsox2^{em1(IMPC)Kmpc}
• Name: quiescin Q6 sulfhydryl oxidase 2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6336131
• Gene: Qsox2 Location: Chr2:26099136-26127411 bp, - strand Genetic Position: Chr2, 18.45 cM
• Alliance: Qsox2^{em1(IMPC)Kmpc} page
• IMPC: Qsox2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 RNA and the guide sequence TGCGAGAGCTCGAAATGAGCAGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Qsox2 Mutation: 30 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)