About   Help   FAQ
Tfpi2em1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
Summary
Symbol: Tfpi2em1(IMPC)Kmpc
Name: tissue factor pathway inhibitor 2; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
MGI ID: MGI:6336138
Gene: Tfpi2  Location: Chr6:3962595-3988919 bp, - strand  Genetic Position: Chr6, 1.81 cM, cytoband A2
Alliance: Tfpi2em1(IMPC)Kmpc page
IMPC: Tfpi2 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences TTCCGCAAGTCTGTTGGCAGAGG, CTCTGTCATAGTAGAACTTGGGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tfpi2 Mutation:  15 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory