Cln8^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cln8^em1(IMPC)Mbp
• Name: CLN8 transmembrane ER and ERGIC protein; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6336204
• Gene: Cln8 Location: Chr8:14931335-14951720 bp, + strand Genetic Position: Chr8, 7.59 cM
• Alliance: Cln8^em1(IMPC)Mbp page
• IMPC: Cln8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein, 2 guide sequences CGGCCAAAGAGAAGGTCTTCTGG, GGCGTCCAGAGCACAACTGCAGG, and a non-contributing oligo, which resulted in an Intra-exon deletion. (J:237616)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cln8 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)