Jak3^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jak3^em1(IMPC)Mbp
• Name: Janus kinase 3; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6336206
• Gene: Jak3 Location: Chr8:72129027-72143221 bp, + strand Genetic Position: Chr8, 34.43 cM
• Alliance: Jak3^em1(IMPC)Mbp page
• IMPC: Jak3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CAGAAGGCGATAGTATGGATTGG, CCGCCGTTTCTTCCCATGGGTGA, which resulted in an intergenic deletion. (J:237616)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Jak3 Mutation: 84 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)