Pcdhgc3^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhgc3^{em1(IMPC)Hmgu}
• Name: protocadherin gamma subfamily C, 3; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6336215
• Gene: Pcdhgc3 Location: Chr18:37939463-37974926 bp, + strand Genetic Position: Chr18, 19.67 cM
• Alliance: Pcdhgc3^{em1(IMPC)Hmgu} page
• IMPC: Pcdhgc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCTTAACCGAGGCTTCCACCATC, TTGCACGCAGACGCGGTGCGAGG, CCACGGACTCTCGCCGCAGCGAC, TCGGCAGTCTGTCGGCCCGCCGG, which resulted in an intergenic deletion. (J:237616)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcdhgc3 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)