Pqbp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pqbp1^em1(IMPC)Tcp
• Name: polyglutamine binding protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6341881
• Gene: Pqbp1 Location: ChrX:7760759-7765469 bp, - strand Genetic Position: ChrX, 3.56 cM
• Alliance: Pqbp1^em1(IMPC)Tcp page
• IMPC: Pqbp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1368 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTGAATTACCCGATAGTGA targeting the 5' side andCTTTAATCTTGGGCAATTAA targeting the 3' side of a critical region. This resulted in a 1356-bp del ChrX: 7895101-7896456 (GRCm38). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pqbp1 Mutation: 4 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)