Hycc1^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hycc1^{em1(IMPC)Ccpcz}
• Name: hyccin PI4KA lipid kinase complex subunit 1; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6341927
• Gene: Hycc1 Location: Chr5:24120274-24235688 bp, - strand Genetic Position: Chr5, 10.53 cM, cytoband A3
• Alliance: Hycc1^{em1(IMPC)Ccpcz} page
• IMPC: Hycc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 RNA and 3 guide sequences AGGTAACTACACCCTAACTTAGG, CAAAGCACAGGGCCGAATCTAGG, GTAACTACACCCTAACTTAGGGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hycc1 Mutation: 30 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)