Teddm1a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Teddm1a^em1(IMPC)Tcp
• Name: transmembrane epididymal protein 1A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6341948
• Gene: Teddm1a Location: Chr1:153767488-153768804 bp, + strand Genetic Position: Chr1, 65.43 cM
• Alliance: Teddm1a^em1(IMPC)Tcp page
• IMPC: Teddm1a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1305 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGAGCTATGAGTCTAACA, GTCATTGAATATCACAGCTC, and GTGACCGGGCCTAGAATACC targeting a critical region. This resulted in a 418-bp del Chr1:153891772-153892189_insGGA, 14-bp del Chr1:153892701-153892714 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Teddm1a Mutation: 19 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)