Dbx2^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dbx2^em1(IMPC)Bay
• Name: developing brain homeobox 2; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6341951
• Gene: Dbx2 Location: Chr15:95521444-95552838 bp, - strand Genetic Position: Chr15, 50.47 cM
• Alliance: Dbx2^em1(IMPC)Bay page
• IMPC: Dbx2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences AAGGCACTGTCCCGCTCCCCCGG, CGGACAGGGTTTTCAGGACTGGG, which resulted in an intergenic deletion. (J:237616)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dbx2 Mutation: 20 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)