Tmem163^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem163^{em1(IMPC)Kmpc}
• Name: transmembrane protein 163; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6341959
• Gene: Tmem163 Location: Chr1:127418079-127605758 bp, - strand Genetic Position: Chr1, 55.77 cM, cytoband E3
• Alliance: Tmem163^{em1(IMPC)Kmpc} page
• IMPC: Tmem163 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 4 guide sequences ACCATCCATGGAACAACTTCAGG, CCCCGAGGGTCACGTGTCTTGTT, CCCTTAGCAGGACTACAGACCAT, TCCATTGACCTATTTCCACCAGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem163 Mutation: 37 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)