Ehbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ehbp1^em1(IMPC)J
• Name: EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342439
• Gene: Ehbp1 Location: Chr11:21955825-22237086 bp, - strand Genetic Position: Chr11, 14.1 cM
• Alliance: Ehbp1^em1(IMPC)J page
• IMPC: Ehbp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ehbp1 Mutation: 78 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)