About   Help   FAQ
Ehbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ehbp1em1(IMPC)J
Name: EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342439
Gene: Ehbp1  Location: Chr11:21955825-22237086 bp, - strand  Genetic Position: Chr11, 14.1 cM
Alliance: Ehbp1em1(IMPC)J page
IMPC: Ehbp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ehbp1 Mutation:  78 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory