Ddx31^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx31^em1(IMPC)J
• Name: DEAD/H box helicase 31; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342462
• Gene: Ddx31 Location: Chr2:28730418-28795583 bp, + strand Genetic Position: Chr2, 19.38 cM
• Alliance: Ddx31^em1(IMPC)J page
• IMPC: Ddx31 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGATAGCGGAGTTATTATG and AATCCAGTCTGCATACAAGC, which resulted in a 635 bp deletion beginning at Chromosome 2 position 28,845,670 bp and ending after 28,846,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276560 (exon 4) and 591 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 24 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ddx31 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)