Tstd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tstd1^em1(IMPC)J
• Name: thiosulfate sulfurtransferase (rhodanese)-like domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342466
• Gene: Tstd1 Location: Chr1:171246601-171247920 bp, + strand Genetic Position: Chr1, 79.41 cM
• Alliance: Tstd1^em1(IMPC)J page
• IMPC: Tstd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGGAAGTCGGCATTCAGAT and AGGGGACTGCTTTAATTGGG, which resulted in a 774 bp deletion beginning at Chromosome 1 position 171,419,685 bp and ending after 171,420,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000906189 and ENSMUSE00000879015 (exons 3 and 4) and 449 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 30 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tstd1 Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)