About   Help   FAQ
Pcdhb9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdhb9em1(IMPC)J
Name: protocadherin beta 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342494
Gene: Pcdhb9  Location: Chr18:37533908-37536962 bp, + strand  Genetic Position: Chr18, 19.48 cM, cytoband B3
Alliance: Pcdhb9em1(IMPC)J page
IMPC: Pcdhb9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGAAGATTCCTCCAAAG and TATGGAAAGTCCCCACTGCA, which resulted in a 2432 bp deletion beginning at Chromosome 18 position 37,400,984 bp and ending after 37,403,415 bp (GRCm38/mm10). This mutation internally deletes 2433 bp from ENSMUSE00000413638 (exon 1) and is predicted to cause a change of amino acid sequence after residue 10, a loss of 813 amino acids, returning into frame 7 amino acids before the termination. There is a 1 bp deletion (C) 3 bp before the 2432 bp deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdhb9 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory