Slc4a1ap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc4a1ap^em1(IMPC)J
• Name: solute carrier family 4 (anion exchanger), member 1, adaptor protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342514
• Gene: Slc4a1ap Location: Chr5:31684125-31711386 bp, + strand Genetic Position: Chr5, 17.27 cM
• Alliance: Slc4a1ap^em1(IMPC)J page
• IMPC: Slc4a1ap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTCCAGGAGGTGATCCC and CCAGTGCTATTAAGCTACCA, which resulted in a 391 bp deletion beginning at Chromosome 5 position 31,531,863 bp and ending after 31,532,253 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226900 (exon 4) and 330 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 328 and early truncation 2 amino acids later. There is a single bp insertion (A) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc4a1ap Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)