Szrd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Szrd1^em1(IMPC)J
• Name: SUZ RNA binding domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342782
• Gene: Szrd1 Location: Chr4:140840312-140867086 bp, - strand Genetic Position: Chr4, 73.38 cM
• Alliance: Szrd1^em1(IMPC)J page
• IMPC: Szrd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACGATCACTTAACCTGA and TGGACCCCATCATTAGGTGG, which resulted in a 2291 bp deletion beginning at Chromosome 4 position 141,118,303 bp and ending after 141,120,593 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001245055, ENSMUSE00001251800 (exons 2,3) and 1986 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Szrd1 Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)