Pcdhb3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhb3^em1(IMPC)J
• Name: protocadherin beta 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342799
• Gene: Pcdhb3 Location: Chr18:37433852-37437638 bp, + strand Genetic Position: Chr18, 19.46 cM, cytoband B3
• Alliance: Pcdhb3^em1(IMPC)J page
• IMPC: Pcdhb3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCTGGGTGGGTCTCTTGC and GGTGATACCAAACCTGTTTC, which resulted in a 2259 bp deletion beginning at Chromosome 18 position 37,301,055 bp and ending after 37,303,313 bp (GRCm38/mm10). This mutation deletes 2259 bp of ENSMUSE00000402031 (exon 1) and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcdhb3 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)