Tubal3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubal3^em1(IMPC)J
• Name: tubulin, alpha-like 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342821
• Gene: Tubal3 Location: Chr13:3974695-3985277 bp, + strand Genetic Position: Chr13, 2.19 cM
• Alliance: Tubal3^em1(IMPC)J page
• IMPC: Tubal3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACTGCATTGTTCTGCC and CTGCACTGGTACATCACAGA, which resulted in a 859 bp deletion beginning at Chromosome 13 position 3,932,618 bp and ending after 3,933,476 bp (GRCm38/mm10). This mutation deletes 859 bp of ENSMUSE00000644094 (exon 4) and is predicted to cause a change of amino acid sequence after residue 133 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tubal3 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)