Zfp593^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp593^em1(IMPC)J
• Name: zinc finger protein 593; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342852
• Gene: Zfp593 Location: Chr4:133970617-133972902 bp, - strand Genetic Position: Chr4, 66.5 cM
• Alliance: Zfp593^em1(IMPC)J page
• IMPC: Zfp593 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGCAAGCCAGACAGCGATGC and ATGGGTCGCTCTCGGCGGAC, which resulted in a 177 bp deletion beginning at Chromosome 4 position 134,245,317 bp and ending after 134,245,493 bp (GRCm38/mm10). This mutation deletes 177 bp of ENSMUSE00000389670 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 a loss of 59 amino acids and then return into frame. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp593 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)