Rcc1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rcc1^em1(IMPC)Tcp
• Name: regulator of chromosome condensation 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6342905
• Gene: Rcc1 Location: Chr4:132059230-132073061 bp, - strand Genetic Position: Chr4, 65.2 cM
• Alliance: Rcc1^em1(IMPC)Tcp page
• IMPC: Rcc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1319 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes single guide RNAs having spacer sequences of AGCCAGTAAATAATCTCGAA and AGTCTGCGAACTGTGTTGGG and 2 single-strand oligonucleotides to introduce loxP sites. The loxP sites were not incorporated into this allele instead a 815-bp Chr4: 132335167 to 132335981_insGACTCCTG. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rcc1 Mutation: 121 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)