Snrnp70^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snrnp70^em1(IMPC)Bay
• Name: small nuclear ribonucleoprotein 70 (U1); endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6342907
• Synonyms: Snrnp70^-
• Gene: Snrnp70 Location: Chr7:45025877-45045166 bp, - strand Genetic Position: Chr7, 29.28 cM
• Alliance: Snrnp70^em1(IMPC)Bay page
• IMPC: Snrnp70 gene page

Snrnp70^em1(IMPC)Bay/Snrnp70^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as morulae. Mutants fail to hatch from the zona pellucida and and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences GATTGACAGATGACGACAACAGG, TAAGCGTGAGTACATGTTTCAGG, CCAACTTACAGCAAGCTGAACCT, ACCCACGCTTTAAATCCACAAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Snrnp70 Mutation: 39 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)