Armc3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Armc3em1(IMPC)J |
Name: |
armadillo repeat containing 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6343228 |
Gene: |
Armc3 Location: Chr2:19204113-19315052 bp, + strand Genetic Position: Chr2, 13.2 cM
|
Alliance: |
Armc3em1(IMPC)J page
|
IMPC: |
Armc3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCACATCAAAATTAACAG and GAGAATACCCTGAGTGAAAG, which resulted in a 406 bp deletion beginning at Chromosome 2 position 19,235,420 bp and ending after 19,235,825 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000290542 (exon 3) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 16 amino acids later. There is a 6 bp deletion (CCTTTC) 15 bp downstream the 406 bp deletion.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|