Sec31a^em3(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec31a^em3(IMPC)H
• Name: SEC31 homolog A, COPII coat complex component; endonuclease-mediated mutation 3, Harwell
• MGI ID: MGI:6355926
• Gene: Sec31a Location: Chr5:100509508-100564093 bp, - strand Genetic Position: Chr5, 48.48 cM, cytoband E3
• Alliance: Sec31a^em3(IMPC)H page
• IMPC: Sec31a gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCAAACTGACTGTAGTGAATGGC, CTAGAAACTGAACACTCTAAGGG, GAACGTTCTGAGTGATCGAAAGG, AACACTCTAAGGGAGCCCCCTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sec31a Mutation: 70 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)