About   Help   FAQ
Cldn11em2(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Cldn11em2(IMPC)H
Name: claudin 11; endonuclease-mediated mutation 2, Harwell
MGI ID: MGI:6355927
Gene: Cldn11  Location: Chr3:31204069-31218473 bp, + strand  Genetic Position: Chr3, 15.14 cM
Alliance: Cldn11em2(IMPC)H page
IMPC: Cldn11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TGCCGAAAAATGGACGAACTGGG, AGTTCTCCCCTGCATCCGAATGG, GTTCTCCCCTGCATCCGAATGGG, CATCCCCACCTGCCGAAAAATGG, which resulted in intragenic deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cldn11 Mutation:  15 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory