Zfp687^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp687^em1(IMPC)Bay
• Name: zinc finger protein 687; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6355936
• Gene: Zfp687 Location: Chr3:94913901-94922759 bp, - strand Genetic Position: Chr3, 40.74 cM, cytoband F2
• Alliance: Zfp687^em1(IMPC)Bay page
• IMPC: Zfp687 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences GCACTGAAGCTGCAGCGATTGGG, GACATGGCGCCTCAGGCTTGGGG, which resulted in an intragenic deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp687 Mutation: 44 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)