Sepsecs^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sepsecs^em1(IMPC)Tcp
• Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6356808
• Synonyms: Sepsecs^-
• Gene: Sepsecs Location: Chr5:52797429-52827050 bp, - strand Genetic Position: Chr5, 28.44 cM
• Alliance: Sepsecs^em1(IMPC)Tcp page
• IMPC: Sepsecs gene page

Sepsecs^em1(IMPC)Tcp/Sepsecs^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos exhibit severe developmental delay as small egg cylinders, poorly organized extraembryonic tissues, and failure of gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPRTCPR1385 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAAGACAACACATTAACCAG and GCCACCATCTTTATTACTAG targeting the 5' side and CAGACAAATAAGACGAACTG and TTGCAGTTCATTTGCTAAGT targeting the 3' side of a critical region. This resulted in a 778-bp del Chr5: 52663813 to 52664590_insG (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sepsecs Mutation: 25 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)