Tkt^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tkt^em1(IMPC)H
• Name: transketolase; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6356816
• Gene: Tkt Location: Chr14:30271088-30296681 bp, + strand Genetic Position: Chr14, 18.79 cM, cytoband B1
• Alliance: Tkt^em1(IMPC)H page
• IMPC: Tkt gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences GCTGGAGTGCTGGACTCCCGCGG, CCATGTGATCTGCCGTGGACAGG, CCAGCTAAACCTGGTGGCGGTTT, CCATGCCAGAAACGAGGATTAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Tkt Mutation: 43 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)